Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ581182
Length 666 bp
Fasta Format > rwhrd10p24
caaaatcatatgaaatgcctaaaggccagtagattacatacaaacgtgag agatacaaacttacaaagtagttctcacatcttcgctctaagcaataata catgtatgtattccccagtaataaccagtcaaacaatatgtaagctcata tgtgcgtgcggcatgcagctggctgaaatatgcattttaaaccatgagac tggcgaccagtaggacgacaaggccaaatcctgctgtggccccgacagag gatgcggtagaggagggtggcggcgggttgctcgcgtccggaccggcagc cggcatgggtgacgacggtgaggaggaactcgggacgacgtcgatcacga ccttcatgctggcggcggcggtggggctgcagtggccagtgatgccgcag atgaagtagcgggtgccggtggcgttgagggggacgacgtcgttgccgga cttgaaggtgttgatggcgctggcggtgctgcaggagtcgtagccagcct tgctgacctcgaccacatcgtgcgccgcgggggagtacttgaagatgatc tcatcacccgggtggaacttcttgttggacacccagttgctgtagtcggt gttgagggtccacgaaccgcccggctcgccaacaccgtaggtcgccgccg acgcggtgcccantaa
Download
page-top