Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ581176
Length 400 bp
Fasta Format > rwhrd10p15
gtcacaatgataaactgaaggagtgattggaaccaaaatgggaccctaat tttgttacaaaataatcaccttactagttgacatacacacacctacaatc ataatcatgtacaccatttgtcaaaccccatagtttcttcatggaggaca aaatacaaatgatacaacactacaaggttgaggtaagaatatcaccatta ctgaggaacagatattcaccaagatccctgccagcaacttaacaaatctc agagaaaaatagattatcaccggaaccacaaggtactgatcaactgatca ctttgctgctccttcaaacaagtgctggatatgtgcctcgacatcttctg gggtgtacttgatgtacaagtcacgtccagtttcaggagctgattttaac
Download
page-top