Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ581022
Length 768 bp
Fasta Format > rwhrd10h06
cgaacggccaccaccaccaccagtctatggggctccctcccgagccagac caggaggcagccaccgcctgctacgctacaagcggcgacagcaaccttcc ccggcaacatcacatacgggggagcctcaaatcttgcgacaacaaccata acacggctacgacatatccagaccacattgcaatgtcattgacagtagca aacactagctaggagcttgcggggcgtcgcaaagccggctttactgcccc tcgctcgagtcgttctttggagcctccctgatctcctcctccgcggtgtc ctccgtgatgtcagaagtccagagggtcaagttatcacgaaggagttgca tgatcaaggtgctgtccttgtaggattcttcgctcagggtgtccagctcc gaaatggcctcatcgaatgcctgctttgcgagattgcaagcacgatcagg cgagttgaggatctcataatagaacaccgagaagttcagtgccagcccaa gcctaatcggatgagttggagccagctcagccaaagcaatatcctgagca gccttgtatgccaccatggtattctcagcagcatccttcctctcaggccc actcttgaattcggcaagatatctgtagtagtcacccttcatcttaagat agaagaccttggactcaggggcagtggaagacgggacaaggtgggtttcg agcagcttgaggatgccatcacagatcttgctaagctcagtctcgatctt gccacggtactccttgat
Download
page-top