Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ222254
Length 551 bp
Fasta Format > whdl12i16
gcgacgctcaagcccccagacgccgcagcgccgccactccacccgcagcg gcaaccatggcggtcggcaagaacaagcgcatctccaaggggaggaaggg tagcaaaaagaaggccgtcgatccgttcaccaagaagcagtggtatgaca tcaaggcgccgctgctgttcaccagccgcaacgtcggcaagaccctcgtg tccaggacacagggtaccaagattgcctcagagggtctgaagcacagggt gttcgaagtatctctagctgatcttcagaacgatgaggaccaggcctaca ggaagatcagactccgtgctgaggatgtgcaagggatgaatgtcctcaca aacttctggggcatggacttcaccactgacaagctcaggtctcttgtgag gaagtggcagacactcattgaggctcatgtggatgtgaagaccactgaca actacatgctccgcatgttcaccattggcttcacgaagagacgcccaaac caggtgaagcgcacttgctatgcccaagcaagtcagatcagacagatccg c
Download
page-top