Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ580983
Length 764 bp
Fasta Format > rwhrd10f03
gcaagacgcagaatcttaacacctcacattttaaccatcttgccagaata tctgaagtacaaatttgcgaaaatgttctaccatactctgtatgtgtccc agatttgtatttcatgcttgttgcctaacagctataaatgtaatgattta gaagaaataatcggactacagcactgttgctaatttcaagctaaaatctg atgaagacttccgagtgcaatggctgagcgtgagaactatcaggcccact gaaaactatctgggtgcctgctgaagctctttcaagaatttctgcctttc gagaaaggggcagcacatctggctgaatctttcttagcccttgtgggtga tcctctttaggagcaaccaggaacaatttcttaaggcaactggcctttgt cagcagaaagtccagcagacgcatctcattgtgatgccccttgaagtttg tcatcttggccaaccgaaggttttctaatccgtcttcaggctgttcttcc tctgccacgtccaagtaattcctcgtgaacgaatcatgggtgtttgttgg tagctgcacgaagagcctctccaactgaggacaggaacaggtcttgagga agctaaaaatgtctgcgagattggagttggccatcccgaacatgagcaat tgaagctccttcaacctgcggagattggtctccttgaggatggtggccag tgacgcagacacgtactggagggcaatgctgcatatggtgagggtggtga tgttggcaaggtga
Download
page-top