Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ580943
Length 755 bp
Fasta Format > rwhrd10c19
acattctctttacagttattgttcacctagccacgcatctacttacatgg acgacatgcttcaaaatgtacaccaaacaaaacaactagggtaaatcctg gtcattctacctccaaagcagtcaggtcaccgctgcgtatacaaccttga tggcttgatcagtcaggacaccgtttcagtgtcagcttttcagttatcag gaactctacacagccttggacatgaccgtgaacggaatgaccacccggtg acctttgtccccgtagaactcgacgtccccgaagctcaccgaagagttgg tcatggtggcgttcacgacaaaggtcacgagctgcttctgcccgctgggg atgaagaactgagccggtgtcgcagacgccgccaccccgtagggggcgtt gcaactgaccgtgtagttctcgtcgctcgccacgttggtgaccgttcgtg ttactgttctcgactggttgagcacagctatggtgatcgacggcaggttt aggtctgctccggtcatggtggaggccccgcagctattgccggtgtagtt cgccactactggagcagaaccatttataccacacagaaaggagaggtagt catcatagctgcaatcaaatatgagcccagggtccaaagcagcagtggca ttggcaaacccattccccatgtcaaaaggtgtagctggagtttgagtgga gtctgggttgctgtatgttcgctgtgacatgatnggattcccctgcttgt cactg
Download
page-top