Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ580930
Length 457 bp
Fasta Format > rwhrd10b21
aggcacactacacacttgggagggatgaaagaaacaaggaagcaagcaag caaccacggatgaacacttcattcactcttgctccatttgcgaactagga acgttttttgcttcaggccccgaagcatcccatgactttcttgggagagt ggccggtggcgcggtacttggcggccatctcctcggccttgaggagttcc tcccctttctttgcctcgaccatcgctctcttctcttcggcctccttgtg gatcattgcagccttgttcttcatcttctctgcgtattccgccttcttct tttccaattgctcctcaatcttcttcagttgagcttctatgtttgctttc ttggtgttctcccatgagagaatagcagatacctttttagtagccttgtt ctcagcctttgtcttctcattctcctcccatgctttaattaaagagttcc tcttctc
Download
page-top