Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ580923
Length 767 bp
Fasta Format > rwhrd10b12
cgatatattgtaaccgacagaatactccaaaaccacagtacattgttaca aattgtgtaagaactgaaaagaaataataacattggaggagacacaaaaa catcccattttgaaaacaaaaaagccttgttcattcccaggctccagcga gagttaggccgccgtcgccgagagaccaaaatccatggcttcttcctttc ctcgaaacaataatcaacactcatgtgacctcgcaaaaatatacagctca aaactggctgttgctcacatcccagttcctctgcggtgaaacacctaagc tatagagaatacaccatacgctgtttttcactagacacagcacctgagaa gttgagctgccaagagctgttatatcgagaggctgttgcacgcgtcgact acggcagcatgtgagctcaatatggcctggcctgctgggtctgctcctag ggttttcgtcacggaggtgaatattgctttgcggaagaaggtatcctcca ttgcctttagaatcccctctgcggcttcaaatctcaggccacacgacaga atcaaacgagcaaccacttcaccaaattgcgttggagctttaggaaggtc aataccaatatcttccaacagcgacccatataacaagcaaccattttcca gatcttcggtcttgaaagttttcttggtgtacagatgctccagaagctta acaagagggtcaacaaaactggcacctttatccagagcaagattgatagc ttctttaacaatctcag
Download
page-top