Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ580907
Length 611 bp
Fasta Format > rwhrd10a15
tgcccataagtaaacaaacttgacaacatccaggacctgactctgaacca aactgaaacagaagcacccgtcactgaacgggcttcacggaccggacctt caaagacgatcaacccctcccaccttgacaccaacttagacgtaaagcaa acacaacacacgccaacaattcaatcgaggtccggtcacgggtctcgggc acggcggcgatcaagcgctgggcttgtgctcgcctgtagcggcggcggcc ttgtcctcctcccctgtcttgtggtaaccaggcagcttgtccatgatctt gcccagcaggcccttcttctccttcgcgtcagggctgctcacctcctcgg gggccggcgccggcgcgtgcactggtgctggagcagcgtgcgtgacgggc accgcagcagcgtcctccggcttcttgtggccgccgggcagcttctcctt gatcttttccaagaagcctttcttctcctcctcgggcactgccggtgccg cctctgtcttcacgtcgccgtcgatcttctcgacgacgacgtcggtgtca tggtggccgccgtgggtctgcacagacgcgggggccgccggtgccggtag ccccgtcacgt
Download
page-top