Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ689850
Length 417 bp
Fasta Format > whrd19e23
gacaccattcaaagctatttgagcgacatgctggctctggtgaaaaagga ggcagcagagcgtaaagcactgggagcccttcctctctatgagagaaccc ttccttgaagacatcttccttgatatgcgccacagcttttgctccttgta gcatcacaatgcatgaaataaaatgcagattatgacactgttcctccttc gggtttcatgtccattgcctgtagcagtttcttgtgccccttcccaaatt aattgcgacagaatttctgttgctgttgctgatataaaagtttattttgg ttgatggaattgttgctatagaagtctgaacaactctgctcttggtcttt tttccattgagcaacgtttttgttgcttgcttctgggtttacgctgccca tttcgacaaaaaaaaaa
Download
page-top