Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ689657
Length 587 bp
Fasta Format > whrd18k19
catcgcctcccaagatcgcagatctgctccggtgagaatccgtcgccatg tcttccagcgaggtcgcctgcacccttgccgccctcatcctccacgatga cgggatccccatcacttctgagaagatcgcgacggtggtgaaggctgccg gaatcaaggttgaggcctactggcccgcgctcttcgccaagctcctggag aagaggagcgtcgatgacctcatcctttccgtcggatctggtggaggtgg tgctccagctgctgctgctgctgccccggctgctggtggtgctgctgccg ctgaagagaagaaagaagagaaaaaggaggaggctaaggaagagagcgat gatgacatgggcttcagcttgttcgactaagcagttcaattccagttctc ctgtggaatcttttatgctaaggattacttatcttatgtgcttttaggtc gaattttgcggatttaatatgtttgagacctaagtatctgtgcaatgagt actgcaaaccaccttgggatggtctttttagaatgaaaatggttttggtg cttggttgaaaagccattgcttgttttaaaaaaaaaa
Download
page-top