Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ222150
Length 662 bp
Fasta Format > whdl11p24
gatctccttaggtttcagttctcctccgcctccggtctcgagagctcgcc agaatggtcgcccacaggttccaccagtaccaggtggtgggtcgcgcgct gccggcccccggcgatgagcagcccaagatctaccgcatgaagctctggg ccaccaatgaggtccgcgccaagtccaagttctggtacttcctgaggaag ctcaagaaggtgaagaaggccaacggccagatgctcgccatcaacgagat ctttgagaagaaccccaccacaatcaagaactacggcatctggctgaggt accagagcaggaccggttaccacaacatgtacaaggagtaccgtgacacg accctcaacggcggggtggagcagatgtacacggagatggcgtcgcggca ccgcgtgcgtgccccctgcatccagatcatcaagactgcgacggtggact tcaagctgtgcaagagggacaacacgaagcagttccacaactcgaagatc aagttcccgctggtgtaccagaaggttcgcccacccacccgcaagctcaa gaccacctacaaggcgacgaggcccaacctcttcatgtgagcgggtccct actctactggcctgtgtgttttagcgtgtaagagtttgaagatttttgca tgtggaagtttt
Download
page-top