Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ689298
Length 694 bp
Fasta Format > whrd17g09
cccgcggccacacctcgaactcgctccctcgagtagatcatctgttccat ccttttgaggctgagatggcggctaccttcaatgttaatgctgaggcagg ccttaaaaagcttgatggctaccttctgtctcgcagttacatctctggat accaagcttccaaggatgacttggctgtgtattcagagttctcagttgct ccaccatcaacttgcaccaatgttgcaaggtggtacaatcacattgatgc actcctgaagctgagtggagttactgcccctggtcaaggtgtgaaggttc tgtcatcagttgtccctgaaacctcaactactgatgttgctgaggctcct gcagctgatgatgacgatgacagcgatgttgacctttttggagaggaaac cgaggaggagaaaaaggcagctgaagagcgcgctgccaaagcaaaggctt ctaccaagaagaaagaatctggcaagtcatcagttttgcttgatgttaag ccatgggacgatgagaccgacatggtcaagctggaggaagctgtccgaag catcaagatggagggccttctgtggggtgcttccaagctcatgcccgttg gatatggcatcaagaagctccagattatgatgaccatcattgatgacctc gtctctgtcgacactcttattgaagaccatctctgcgttgaacc
Download
page-top