Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ688719
Length 215 bp
Fasta Format > whrd15c08
ggatcgtgtggtagatgtgttatggttattattgcaagatttggggctcc ccatatgttatgttgccagggaaggttgtggtcgccgcttgtagcgtagc aggcggggactgcctccttggtctggcctggggggagccccatacagtgg tggtggtggccgttcgtattttcgttctgccttaatattgcttcttatcg tgagtaaaaaaaaaa
Download
page-top