Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ687764
Length 669 bp
Fasta Format > whrd11g18
gcgccgccgccgcctccttccgcaggagctccctccccgcgggcgcgatg gtgtacatcaagaaccagaagacaagggcgtactccaagcgtttccaagt caagttcaagagaaggcgccaggggaagaccgactacagggccaggctga ggctcacgaaccaggacaagaacaaatacaatacccccaagtaccgtttt gttgtgcgatttaccaacaaggatgtcactgcacaaattgtctatgctac cattgctggtgatatcgtgatggccgctgcctactcccatgagttgcctc gctacggtcttgaagttggcctcaccaactatgctgcagcctactgcact ggtctgcttttggctcgtcgtgtgctcaagaaccgtgatcttgatgagga gtatgaaggcaatgttgaggccacaggtgaggacttctctgttgagcctt ctgatgagaggaggcctttccgtgcgctcttggatgttggtcttattagg accaccactgggaaccgcgtgtttggtgcccttaagggagctttggatgg tggtcttgacattccccacagtgacnagagatttgctggttttaagaagg acgagaagtcgctggatgctgagattcaccgcaagtacatctttggaggg catgttgctgactacatga
Download
page-top