Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ692327
Length 680 bp
Fasta Format > whrd8n05
cgcggccacacctcgactcgctccctcgagatcatctgttccatcctttt gaggctgagatggcggctaccttcaatgttaatgctgaggcaggccttaa aaagcttgatggctaccttctgtctcgcagttacatctctggataccaag cttccaaggatgacttggctgtgtattcagagttctcagttgctccacca tcaacttgcaccaatgttgcaaggtggtacaatcacattgatgcactcct gaagctgagtggagttactgcccctggtcaaggtgtgaaggttctgtcat cagttgtccctgaaacctcaactactgatgttgctgaggctcctgcagct gatgatgacgatgacagcgatgttgacctttttggagaggaaaccgagga ggagaaaaaggcagctgaagagcgcgctgccaaagcaaaggcttctacca agaagaaagaatctggcaagtcatcagttttgcttgatgttaagccatgg gacgatgagaccgacatggtcaagctggaggaagctgtccgaagcatcaa gatggagggccttctgtggggtgcttccaagctcatgcccgttggatatg gcatcaagaagctccagattatgatgaccatcattgatgacctcgtctct gtcgacactcttattgaagaccatctctgc
Download
page-top