Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ692065
Length 705 bp
Fasta Format > whrd7o10
gtgctggtcgttcagcgcgtccggggcgttggagggggccaactacctgg ccacgggcaagatggaggtgctctccgagcagcagctggtcgactgcgac catgagtgcgacccagcagaacctgattcatgcgatgctggatgcaacgg tgggttgatgacttcagccttcagctatctgttgaaatctggtggccttg agagagaaaaggattacccttacaccgggaaggacggtacctgcaaattt gagaagtccaaggttgctgcttcagttcaaaacttcagcgttgtcgctgt tgatgaagaacagattgctgctaaccttgtgaaatacggaccgctggcca tcggtatcaacgccgcatacatgcagacatacattggcggagtgtcatgc ccatacatctgcggcaggcacctcgaccacggcgtcctcctcgttggcta cggggcgtccgggttcgcaccttcccgcttcaaggagaagccctactgga tcatcaagaactcatggggcgagaactggggggacaagggttactacaag atctgcaggggctccaacgtgcgcaacaagtgcggcgtcgactccatggt ctccacggtgtccgccatgcacgcctcgaaggaggagtaggctctgttct ggtctgatcgtcanccctcgtggagtcgatcttggtttcggtgtatcgct anaaa
Download
page-top