Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ690282
Length 391 bp
Fasta Format > whrd1p02
atcgtcttcctcgtcttcatcggtcatcgtctactccgtcggctgctgcg ccttcaggaacaaccgccgcgaccaccgcaacggcggcgggtacaagcag cagggcgcgtacgcttgatcgcgcgcttggctcggttatttattgcttgg attggatggatgcgatcgtctcgtcgtgtcatgcatcttcgtcgtcgtgt ttctcttaggatggcctgatctagctttgtacaggcgagatgtgctctga tcacctactagttaggttttactccgtggtcatgaggagggatgtgtata tatattttctgttctttgatatttattatcgcagaccattatatatgtaa cagattattctggagttatttatttcatattaaaaaaaaaa
Download
page-top