Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ690208
Length 678 bp
Fasta Format > whrd1k16
aacacctcctagttacaacaatgctcagccaccaccacaagctgaggtga ggtacacaccgccagcgatgaaccctcctgtcgtcccacctgtggttgcc ccctcaaagcccatgccggacacgattctcggcaagcagtacgaggatgt gcgctctgtctactcccttggcaaggaacttggtagggggcagttcgggg tgacgtacctttgcactgagattagcactggcaggcagtatgcttgcaag tccatatccaagcgcaagctcgtgagtaaggccgacaaggaggatatccg cagggagatccagatcatgcagcacctatctgggcagccgaacatagtgg agttctgtggagcatatgaggacaagggcagcgtgcatgttgtgatggag ctctgtgcaggcggggagctgtttgatcggattattgccaaggggcacta ctcagagcgtgcagctgctacaatctgcagaggagttgtgaatgttgtca atgtttgccatttcatgggagtgatgcaccgcgatctgaagccagagaac ttcttgctcgcgaccaaggatgagaatgctgtgctcaaggccactgattt cgggctttcggtcttcattgaagaaggaaaaatgtatagggacatcgttg gaagtgcttattatgttgctcctgaagt
Download
page-top