Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ690096
Length 573 bp
Fasta Format > whrd1d16
agggagaggagactacagatacatactgagagaaaatgccagcgcttact ggtcaggtgaagtggttcaacgagagcaaggggttcggctttatcacccc cgacgacggcagcaaggacgtcttcgtgcacttctcggcaatcgttgacg ccggcttcaagaccctcgccgagggccagcgtgtcgaattcagaatcgaa agcggcgcaaaaggcccgtccgccgccaatgtcaaggccatataggagga ggagcaatatcggcatccttttgtaatttgctccacccgaccgagcaaat ggagtccaagagtatgctgctttaggaaggattgttatttgtttgtgttc tattctcaccagtgcactaaaatctgtactgtttctttcttttcttttct tttcttttcacatcaaatctacacgggttaattactgttgcgttcgggtt tgcaaggaatgtggattttgtttaagtcaaatctttaaacttcgaataag tttgtacaaagatgtactgtatcaatattcacagtaccaaatcaatatca ataaattatcatgaaaaaaaaaa
Download
page-top