Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ690077
Length 729 bp
Fasta Format > whrd1c02
agcggcgacagacgcagacgcagatttggcattcagaaaaaatttaaatc gtgaactgtgaagatgacggcaccagcggagctttcccgtgaggagaatg tgtacatggctaagctcgctgagcaggctgagaggtacgaggagatggtt gagttcatggagaaggtggccaagaccgtcgactccgaggaactcactgt ggaggagcgcaacctcctctctgttgcatacaagaatgtgattggagccc gccgtgcctcatggcgcatcatctcctccattgaacagaaggaggagagc cgtggcaacgaggaccgggtcacactcatcaaggaataccgtggcaagat cgaaactgagcttagcaagatctgtgatggcatcctcaagctgctcgaaa cccaccttgtcccgtcttccactgcccctgagtccaaggtcttttatctt aagatgaagggtgactactacaggtatcttgccgaattcaagagtgggcc tgagaggaaggatgctgctgagaataccatggtggcatacaaggctgctc aggatattgctttggctgagctggctccaactcatccgattaggcttggg ctggcactaaacttctcggtgttctattatgagatcctcaactcgcctga tcgtgcttgcaatctcgcaaaacaggcattcgatgaggccatttcggagc tggacaccttgagcgaagaatcctacaag
Download
page-top