Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ687585
Length 711 bp
Fasta Format > whrd10m05
atatcaaggatttgcagattttgagaggttcacaacagacgagcaaagct ggttgcgcctttctgaagtatgaaacaaaagagcaggctgtggcagctat cgaagctctaaatgggaagcacaaaatagagggttcaagtgtgcctttgg ttgtaaaatgggctgacacagaaaaggaaaggcaggctcgaaaagcacaa aaggctcaatttccgcagtctaatatgtcaaatgcaaatgccatgcaaca aagttcattatttggtgctttacagatgggatatgtgcctccgtataatg gatttggctaccagccacaaggaacctatggacttatgcagtacccttta tctccgatgcaaaatcaagcaggcttcccgaatatggttcagcctgtcaa tcaaggaagctcaatacggggcgttaattctgaattatcccctaattcac ttcctaggtcattcaattcaatgcagttgggcagcccttatccagctggg cctggtatgcagtatcctgggtcatatgctggtggtggcatcaatagtcg tccttacatgaactctcataattcagtcaataaagttccgaatgcaaatg ctacatctcccacatcttcaagcaccagcagcaacactggtcctcagcta gagggtcctcctggagccaacttgtttatctatcacatcccgcaagaatt tggcgaccaag
Download
page-top