Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ687481
Length 712 bp
Fasta Format > whrd10g06
atcaggcggcgcagctcggtcttaagaccacctgcatcgagaagaggggc gcgctcggggggacctgcctcaacgtcggctgcatcccgtccaaggctct tctgcattcgtcgcatatgtaccatgaggcaaagtcttcttttgcacacc atggcgttaagttctccaatctggaggtagatctgcctgcaatgatggct cagaaagacaaggctgtttctgggcttacaaagggcatcgaaggcctgtt caagaagaacaaggttgagtatgttaaagggtttgggaagcttgtctctc cgtcagaggtatctgtggatttagttgatggtggtagcactatcgtcaaa gggaagaacataattgtcgccactggctcagatgtgaaatctctccctgg agttacaattgatgagaagaagattgtgtcatctactggggctcttgcac ttacagaaataccaaagaagttggtggtcattggagctggatacataggt ctagagatgggttctgtctggaacaggctagggtctgaagtgactgtggt tgaatttgcccctgatattgtcccatcaatggatggagagataaggaagc agtttcagcgtatgctggagaagcaaaagtttaagttcatgctcaagaca aaggtagtcggggtcgatacttctggaagtggtgtcaagttaactgtgga gcctgcagctgg
Download
page-top