Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ687480
Length 708 bp
Fasta Format > whrd10g05
cgcgacgtcgccaccacccccgccgagctcgtcgccttcttccacgacat gtccctcatgcgccgcatggagatcgccgccgactcgctctacaaggcca agctcatccgcggcttctgccacctctacgacggccaggaggccgtctgc gccggcatggaggccgccatcacccgcaaggactccatcatcaccgccta ccgcgaccactgcatcttcctctcccgcggcggcgacctcgtcaccgcct tcgccgagctcatgggccgccaggtcggctgctcccgcggcaagggcgga tccatgcatttttacaagaaggacgccaacttctacggcggccacgggat cgtcggcgcccaggtgcccctcggctgcggcctcgccttcgcgcagaagt acaggaaggaggacaccgtctccttctccctctacggcgatggcgccgcc aaccagggccagctctttgaggcgctcaacatctcggccctctggaagct gcccgccatactcgtctgcgagaacaaccattacgggatgggaacggctg agtggagggcggccaagagcccctcctactacaagcgtggtgactatgtg cctggattgaaggtcgacggaatggatgttcttgctgtgaagcaggcatg caaatttgcgaaggagcatgccattgcaaatggcccaattgttcttgaaa tggacacg
Download
page-top