Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ687474
Length 668 bp
Fasta Format > whrd10f17
gcggcgacaggagcacctggtcgaccttgtagccatcgagggcaaggtcg cgccgtcctcattgccggtgacactccccggcgaccaggaggcgtggagt gtgcagctgttccggtccatcgacaacatggccaccgtgggcttccccga ctccatggaggctgcctacgaggccggcctcgtccaggacaagcaccatg tgttcgagaggagcatccaggacgcctacatccacgcaatacgtgccgca aagaacttcatctacatcgagaaccagtacttcatcggcagttccttcca gtggaagtccggcgtcggcatagatccggcggcagtccaggcgaatcaca cgatccctagagagctctcgctcaagatcgtgaggaagatcgaggccggt gagcgcttcgcggtctacgtcgtggtgcccatgtggtcggaaggctaccc tacgcatatgtacaggcaggcgatgctggacaaccagaggaggaccatgt ccatgatgtacaacgacatcgccgctgcgctgcaggccaagaacatagac gctgatcccagggactaccttaccttcttctgcttagggaaccgcgaggc gaggaacccagagggcggcgaataccagcctgcgaaaatcccaaaggacg ggacggactatgccaagg
Download
page-top