Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ687467
Length 706 bp
Fasta Format > whrd10f07
aacagtaagatcgatcagtagcaatggcgccctccaagctcgcccttttc ctcgccctgaacctggccctccttgccgcggcgcatggctgcgagcccta ctgcccaccagtcgtacctaccccaccgatcctcccaccgtctgtgccgt cgactggcgggggcagctgctcgatcaacacgctgaagctgggcgtgtgc gccaatgtgctgaacctgctgaagctcaagatcggcgtgccggcaaatga ggagtgttgcccgctcctggctgggctcgctgacctcgacgcggccgtgt gcctctgcaccgccatcaacgctaacatccttggcatcaagctgaatgtc cccatcgacatcgtcctcctcctcaaccagtgcggcaagaagtgcccctc cgacttcacgtgccccatctgatccatccaaccatcgatgaatgttatac atgcataatcgttgcattcgtaactagtttgcatgccatacgtacacacc agacgtatattttctatgtttcagttcatgtactatatgtcaggcgtttg catgggctccctcgctcgtgcatgcatgcttgataagcttgtgatttatc aacgatcagtgtatcccgttatggtatctaaatgcatgattcatcctcgt gccgaatcggcacgaggatcaaacgcggcggcggcagcagcggcagcgca agangt
Download
page-top