Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ687463
Length 685 bp
Fasta Format > whrd10f01
tcttgcccccacagaagctgatgtcagtgatctgcaaagtgaggctgctg ctattgatgtgactagtcctaagcaagatactatggtagttgaagcactg cacactaattccggaggttctgctagtcatctgcctgctgctttacaatc aacggactcaaaccagcatgcagaacggaaaggaagttcagagaacagtg gctctaaattttttgcatctgggaagaaaacagaggaaatggaaggaact ttggataagaatacggataacaatcttattcaggcaaatgccgatatagc tttaggaagacattctccttcagaggacaaaagagaggacagttgtgccc atgtagttgatggtggcctgttgggaagcaaacaaactcttcttgaagtc gtttctgctgtaaacactgatggctctgaggaagcactcaatgcttcgtc tacccattcgaataaagatgccacctcggnttgtgaagtaacaaaggatc ctgagagccatgtaagagtgtctgtactggcctctgctgctatgaacgct cgtgatgactgtgaggaagttcacaatgttccatccacccattctgatnn agggggcagcatggtagaagttgatgcgtctagagatgatgctacctcta tttgcgaagtatgcaaggatcctganagtaatgta
Download
page-top