Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ687462
Length 661 bp
Fasta Format > whrd10e22
gacgatggcgccggcgctgaaggtctacggatgggcggtctcaccgttcg tggcacgcgcgctgatctgcctggaggaagcaggcgtcgactacgagctc gtccccatgaaacgtgaggccggcgaccacctcctgccggacttcctcgc caggaaccccttcggccaggtccccgttctcgaggacggcgacctcaccc tcttcgaatcgcgcgcaatcgcgaggcacgtgcttcgcaagtaccagccg gagctgctggtgggcgacggctcgccggagtcggcggcgatggtggacgt gtggctggaggtggaggcccaccagtacaatccctcggctggtgccatct cgatccagtgcctcctcgtcccgttcctcggcggcacgcgcgatcaggcc atcgtcgacgagaacgtcgtcaagctgaggaaggtgctggaggtgtacga ggcgcggctgtcggcgtccaagtacctcgccggggagtcggtcagcctcg ccgacctcanccacttcccgctcatgcactacttcatggagacggagtac gcgtcnctggtcnaggagcgcccgcatgtcaaggcgtggtggganganct gaangccangccggcggcnangaangtcacnganttcatgtcnccnnact ttgnnatgntg
Download
page-top