Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ687459
Length 540 bp
Fasta Format > whrd10e17
ggccgctgcagctctcgccggggctagggtttcgtcgatcgatcgatcag tcgacgcgagcgggagcgaagatgatcgaggtggtgctcaacgaccgcct ggggaagaaggtgcgcgtcaagtgcaacgaggacgacaccatcggcgacc tcaagaagctcgtggcggcgcagaccgggaccagggccgagaagatccgc atccagaagtggtacaccatctacaaggaccacatcaccctcggcgacta cgagatccacgacggcatgggcctcgagctctactacaactagcctcatc acccccgccatgttcgtcacctatcgttgcctgtgatgagcgttggttgc attccagtcccagtgtcttcagagctcgatgtgtgggctgaactccagcg agctactatataagtagtgcattattgtacccatgatgattattgacagc ctgaacatacttttcctgtgatcgacctgcgaatctaatgtgctgttact gtgaagtttataaataacataaactgtgttaaaaaaaaaa
Download
page-top