Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ687456
Length 836 bp
Fasta Format > whrd10e14
cccctcaatctcgccggaaatctcctccgacagatcgaagcgaaggccat ctcgtcctcctcctcaagatgcagatctttgtgaagaccctcactggcaa gaccatcacccttgaggttgagtcctcggacactatcgacaacgtcaagg ctaagatccaggacaaggagggcatccctccagaccagcagcgtctcatc ttcgctggcaagcagctcgaggatggccgcaccctggctgactacaacat tcagaaggagtccaccctccaccttgtgctaaggcttcggggtggcatgc aaatcttcgtgaagaccctcaccggcaagaccatcacccttgaggtcgag tcatctgacaccattgacaacgtcaaggcgaagattcaggacaaggaggg catccccccggaccagcagcgcctcatcttcgctggcaagcagcttgagg atggccgcacgctcgccgactacaacatccagaaggagtccaccctccac ctggtgcttaggctccgtggtggcatgcaaatcttcgtcaagaccctcac tggcaagaccatcacactggaggttgagtcgtctgacaccattgacaatg tcaaggcgaagatccaggacaaggagggtatcccgccggaccagcagcgc ctcatctttgccggcaagcagcttgaggatggccgcacccttgcagacta caacatccagaaggagtccaccctccacttggtgctcaggctccgtggtg gtatgcaaatcttcgtcaagaccctcactggcaanaccatcacactggag gtcgagtcttcggaacanttgacancntaangcgaa
Download
page-top