Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ687455
Length 685 bp
Fasta Format > whrd10e13
ctcgctcgctgcccgccgtccacgcgctcgtcctcgacatgttctgcgtc gacgcccaggacgtcgcagccgagctcaagctgccggtctactactcgtt cgcctccgctgccggcgacctcgccatcttcctcaacctgccgagcaagt tcgccagcaatacggccaaggtaaaagagctcggcgactccatcatcacc ttcccgggtgttcctcctttcaaggcttcggagctgccgtccgaagttat cgccgacgatgaagcattcgtgtacgtcttacgcatgtttcagcgaatgg cggaggcgaaaggaattcttacaaattccttcgactcgctggaaaagccc gcactgagcgctctcagcgaaggactttgcgtccctggtcgtgcgacgcc gccggtctactgcatcgggccgttggtctctggaggcggagacaaggagc acgagtgcctccgctggctggacgcgcagccggaccagagcgtagtgttc ctctccttcggcagcctgggcacattcaccagtaagcagctagaggaaat tgcaattggtttggagaagtcaggggagaggttcctgtgggttgtgcgga gcccgcgcagtcccgaccanaagcacggggatccgctgccggagcctgac ctcgaggcgctcatgccggaagggttcttgganaa
Download
page-top