Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ687454
Length 721 bp
Fasta Format > whrd10e10
tgatgctcgcgaagaagctcggtgagcttgacccattgatgaagccaaag caagataggtatgccctccgcacatcaccgcagtggcttggccctcagat tgaggttatccgtgctgccaccaagtcgattgagcgggaaatcaactccg tcaacgacaacccactcatcgacgtctcccgtggcaaagctatccatggt ggcaacttccagggcacacccatcggtgtgtccatggacaacaccaggct tgccattgctgcgattggcaagctcatgtttgctcaattctcagagctgg tgaacgacttctacaacaacggtcttccttccaacctctctggtgggcgc aacccaagcttggactatggcttcaagggtgccgagattgcaatggcctc ctactgctccgagcttcagttcttgggcaaccctgtgaccaaccatgtcc aaagtgcggagcagcacaaccaagatgtcaactctcttggtctcatctcc tcgaggaagaccgccgaggccattgacatactcaagctcatgtcctcgac gttcttggttgcgttgtgccaggctatcgacctccgccaccttgaggaga atgtcaagaatgctatcaagagatgtgtgaagactgtagctaggaagaca ctgagcaccgataccaatggccatctccataacgcgcgcttctgcgagaa ggaccttctgctcacaatcga
Download
page-top