Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ687450
Length 541 bp
Fasta Format > whrd10e06
aggccgctgcagctctcgccggggctagggtttcgtcgatcgatcgatca gtcgacgcgagcgggagcgaagatgatcgaggtggtgctcaacgaccgcc tggggaagaaggtgcgcgtcaagtgcaacgaggacgacaccatcggcgac ctcaagaagctcgtggcggcgcagaccgggaccagggccgagaagatccg catccagaagtggtacaccatctacaaggaccacatcaccctcggcgact acgagatccacgacggcatgggcctcgagctctactacaactagcctcat cacccccgccatgttcgtcacctatcgttgcctgtgatgagcgttggttg cattccagtcccagtgtcttcagagctcgatgtgtgggctgaactccagc gagctactatataagtagtgcattattgtacccatgatgattattgacag cctgaacatacttttcctgtgatcgacctgcgaatctaatgtgctgttac tgtgaagtttataaataacataaactgtgttaaaaaaaaaa
Download
page-top