Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ687446
Length 710 bp
Fasta Format > whrd10e02
ctcaccccgcccttctcatcccgacctagggtttgtgcgcccctgcgagc tccgtccccgctccacccagtagcgggcgtaccagccgccccccggagcc gttcgagcacagacctcctcgcagaggcaccgccgccgccaagcacgagg ttgtttctagctaaatccaaggaattggtgcaatatcaggtcatggaggg gagtaagaacatgcaagagtcagacactgcatctgttgtcatagtaccca gggagcctgctgtcattatcaatggtgtcccagacttgcctcctgatttc gcatctggttcacaacctgcagtaagagatgctccaggatctcgagttga tcatcgctttggtgaatggctagaagggcggaaagtgagaaagcagtttg gagacaagtattttgcagggaaagttgtcaagtatgacagtgaaagcaat tggtacagtgttgtctatgatgatggagaccaggaagatcttgaatggct tgaactggaggagatcctgctaccattggacataaccattccactcagaa aacttgttatggacaaattcaaacatcagaatgctgttcctgactacaga cttaagggggctagatcatcgcaaggaactaatggtactagcaaccagat ggtggttagagcagtaaatggccaacagtcaaacaacctaccactaccag ggttgcttca
Download
page-top