Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ687437
Length 468 bp
Fasta Format > whrd10d12
ccgcgcagtccacaccgaacgaccgtctcccgtcgaacacacaatctcac aaaatggaaaccgctaaggcccccgtcaagctcgtcaaggtcactcgtgt ccttggccgaaccggctcccgtggtggtgtcacccagtgccgtgtcgagt tcatggacgaccagacccgttccatcatccgcaacgtcaagggcgctgtc cgtgagaacgacattctctgcctgctcgagtccgaacgcgaggcccgccg tctgcgataaacgcttgctttggggagaagtggcgcgttggcattttcct tcggttccggagttcttcacgaatggatcggctttacacatggtcatcat gagggcatggatgcgttagtctggtgccgcgaggcgctgtgaatggagag gatatgcgaggagacatgataaccaggaaatcaacgaactgggacttgct cctgaatgaaaaaaaaaa
Download
page-top