Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ687435
Length 617 bp
Fasta Format > whrd10d10
gcccctccgtcctcttcgtctccggtaggccaggcnagttaacagctcca gcagccatgggaaagganaagatccacatcagcattgtggtcattggcca tgtcgactctggcaagtcaaccacgactggccacctcatctacaagcttg gaggcattgacaagcgtgtgattgagaggtttgagaaggaagccgctgag atgaacaagaggtctttcaagtatgcctgggtgcttgacaagctcaaggc tgagcgtgagaggggtatcaccattgatattgctctgtggaaattcgaga ccaccaagtactcctgcactgtcattgatgctcctggtcaccgtgatttc atcaagaacatgatcaccgggacctcccaggctgattgtgctgtgcttat cattgactccaccactggtggttttgaggctggtatctccaaggatggcc agacccgtgagcacgctctccttgctttcactcttggtgtgaagcagatg atctgctgctgcaacaagatggatgccaccactcccaagtactcgaaggc ccgttatgaagaaattgtcaaggaagtctcttcatacctgaagaaggttg gttacaaccctgacaag
Download
page-top