Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ687426
Length 709 bp
Fasta Format > whrd10c21
agctcggtctcggcgtangaagaagaaagggaagcctaggataggccctg ctcaccttccgccgccaccaaacgcttcttggtggggcaaggaaggaatt gccggaaaagcctctcccctgcctcccgttctcttcttctttaactagcc ttggcgattgcctagaggttcagaagggcagagcgcgggagccggacaga gagaggggcaggtttgtggggatcgggaagatgatggcgaggcgggcctt ggttgccattgcggttcttgcggcggcggcggcgctgcttgttgcggcgg aggcccagcaggcgccggcgcagcagggccaccagacagagaggatctca gggagtgctggtgacgtgctggacgatgaccctgttgggaggctcaaggt gtttatctatgacctccctggaaaatacaacaagaagctgctgaagaaag acccaaggtgcctgaaccacatgttcgccgcggagatcttcatgcaccgg ttcctgctgtcgagcgcggttcggaccactaatcccgaggaagcggattg gttctacacacctgtgtacccgacatgcgacctgacgccttcgggtctcc ccttgcccttcaagtctccgcggatgatgcgcagcgcgatcgagctgatc gcgacgaaaatggccttactggaatagatcggagggggcagatcatttct ttgtcacgc
Download
page-top