Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ687424
Length 356 bp
Fasta Format > whrd10c18
gcacaacagaatcatgtggggcgaggttaagctgtgatcttcaaaacatt gcaagtttggtgactcttctgcgagagacatgtggccctctttgaaggat gcagtttcacaggatggtggcgagtcagttattcacaagacatctaataa agccatccaacaaacggctgcgaacgagcaatttgtcttcctgaacatgg ctgtagctgtgcgtcaagctcaaaccatttgtttatcttagttttgaaca aaagaaatcttattgtcttatgtaaattctgtttaccgatgtagttggat gctaccaaatggatctttgaatgttgaaatactgatgttttgagtcaaaa aaaaaa
Download
page-top