Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ687423
Length 302 bp
Fasta Format > whrd10c16
gcctctgcaccgccgtcagggcaaacgtactcggcatccacctcaacgtg cctgtggacatcagcctcctcctcaaccactgcggcaagacgtgcccgtc cgagttcacttgcccggcccattaacggacgcgtactgctcactggcgcc gaataagatttgctttcgatccgtactccgttgttatttttcgtgagttg tggaaccgttccgcttccacatttgaatccttgtaaccagtactacaact attgtttttggcaaacaaccatgtgaattgatattgagatataaaaaaaa aa
Download
page-top