Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ687422
Length 470 bp
Fasta Format > whrd10c15
gttggatcgccaagcctatcacaaccctcctcctttacccgggcttggga ccggctatgcctagaagacataggcggagttgtagtgtactaaccagtaa caaggaaaaatgtttacatagcagtagacatttttttaaaataatgctca ataatttatgtcagcaggatgacgctggcgatgaaatgagggattcaagc aagcctgaggatgagcagtagtgaagggtcctagctactgccctctttct ctcttagccttcgggtagttatgatgcttgtacaaggaccattttcgtgt gtcctttgttgctgggtcttttacctaccctttctttcgttatattgtta tacatcgccgtcctcgtgcattattttactttacaacttgaatcctgctc gtgtatgcacgggttccttaagatttgaaccagagggttcaactcttgct tcctataatcaaaaaaaaaa
Download
page-top