Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ687420
Length 749 bp
Fasta Format > whrd10c12
acccgaacccaaccctcgaccgcagcgactcacagcggcgcaaccatggt gctcgagtcgacgatgatctgcatagacaactcggagtggatgcggaacg gcgactactcgccgtcccgcttccaggcgcaggccgacgccgtcaacctc atctgcggcgccaagacccagtcgaacccggagaatacggtgggcgtcat gacgatggccggcaagggcgtgcgcgtgcttgtcacccccaccagcgacc tcggcaagatcctcgcctgtatgcatgggctggaagttggagctgaagca aacttggccgcggctattcaggttgctcagctggcgctaaagcatcgcca gaataagaggcaacagcagagaattattgttttcattggaagccctgtga catacgacaagaaggtcttggagacaatagggaagaagctgaagaagaat aatgttgcccttgacgttgttgattttggtgaaactgatgatgaaaagcc tgagaaactggaagcgctgatcgctgctgtgaacagcagtgatagcagcc acatcgtccatgtccctccgggtgaccatgccctttctgatgttcttata agcactcctatctttactggcgaagaaggtggaagtggctttgctgcttc tgcagcagctgctgcagccaccggagctactggatatgattttggcgtgg acccaaatgtggacccagagttggcacttgccctacggttgtctatgga
Download
page-top