Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ687418
Length 713 bp
Fasta Format > whrd10c09
atgacatagtgaagttctgcaaaaatgagggtcttgttcttctggctgac gaggtataccaagagaacatctacgctgacaacaagaaattccactcttt caagaagatagtgagatccttgggatacggcgaggaggatctccctctag tatcatatcaatctgtttctaagggatattatggtgagtgtggtaaaaga ggtggttacatggagattactggcttcagtgctccagtaagagagcagat ctacaaaatagcatcagtgaacctatgttccaatatcaccggccagatcc ttgctagtcttgtcatgaacccaccaaaggctagtgatgaatcatatgct tcatacnaggcagagaaagatggaatccttgcatcgttagctcgtcgtgc gaaggcattggaggttgcattcagtaaacttgagggaattacttgcaaca aggctgaaggagcaatgtacctgttccctcaaatctgtctgccacagaag gcgattgaggctgctaaagctgctaacaaagcacctgatgcattctatgc tcttcgtctccttgagtcgacaggaatcgtcgttgtccctggatctggat ttggccaggttcctggcacatggcacttcaggtgcacgatccttccgcag gaggagaagatcccggcaatcatctcccgcttcacggtgttccatgagac gttcatggcagag
Download
page-top