Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ687412
Length 502 bp
Fasta Format > whrd10b21
actctttattaagcatgggaggagaatgagaagacaaaggctgagaacaa ggctactaaaaaggtatctgctattctctcatgggagaacaccaagaaag caaacatagaagctcaactgaagaagattgaggagcaattggaaaagaag aaggcggaatacgcagagaagatgaagaacaaggctgcaatgatccacaa ggaggccgaagagaagagagcgatggtcgaggcaaagaaaggggaggaac tcctcaaggccgaggagatggccgccaagtaccgcgccaccggccactct cccaagaaagtcatgggatgcttcggggcctgaagcaaaaaacgttccta gttcgcaaatggagcaagagtgaatgaagtgttcatccgtggttgcttgc ttgcttccttgtttctttcatccctcccaagtgtgtagtgtgccttgtgt gtaaagtctgccgtctctgtatatacacattgctcccaggacaaaaaaaa aa
Download
page-top