Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ687407
Length 359 bp
Fasta Format > whrd10b14
acccgtggagcagcttcttaaggctgttgatggtataactctggcagatg tatcaactgttgctgagaagatcatctcgtcaccattgacaatggcatct cacggaaacgttctcaatgtaccagcctacgagacggtgcgtggcaagtt cagctcgaaatgaggaggcttctgaacaagttaactgttcatattttttt ctctcccaagatcatctatggtcacatttttcacaaggaaaataagatgc atacaattttggtcattaactcctactgccggaccactttgggatcttgt ttttttcctcgcagaaacgtgtatccacctgagttgggtggtttgatgta naaaaaaaa
Download
page-top