Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ687406
Length 390 bp
Fasta Format > whrd10b13
gggcgccagcattggcatttggtgaaaggaaacccgtggagcagcttctt aaggctgttgatggtataactctggcagatgtatcaactgttgctgagaa gatcatctcgtcaccattgacaatggcatctcacggaaacgttctcaatg taccancctacgagacggtgcgtggcaagttcagctcgaaatgaggaggc ttctgaacaagttaactgttcatatttttttctctcccaagatcatctat ggtcacatttttcacaaggaaaataagatgcatacaattttggtcattaa ctcctactgccggaccactttgggatcttgtttttttcctcgcagaaacg tgtatccacctgagttgggtggtttgatgtaaaaaaaaaa
Download
page-top