Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ687405
Length 762 bp
Fasta Format > whrd10b12
ctcagcaaaagatggttcctgagaagatagttcatcacattgtcaaggag ctactggggtctgataaaaaggcttgccctgacgaggaacacgtcgaagc aatttgccagttcttcaatacgattggtaaacagcttgatgagaacccaa agtctcgccgaatcaatgatacctacttcgtccagattagggagctagta gcgaaccctcagttgaccccacgttccaagttcatggtccgggatttgat tgatctccgttctaacaactgggtgcctcgacgtgctgagatcaaggcga agacaatcagcgagatccacacagaggctgaaaagaaccttggattacgt ccaggggccacagcgaacatgaggaatggccgtaatgcaccaggtgggcc tctttcgcctggaggtttttcagtgaaccggccaggaacaggaggtatga tgcctgggatgcctggatctagaaaaatgcctgggatgcctgggttagat aatgataactgggaagttcagcgttctagatcaatgccaagaggcgatcc gcttcgcaaccagggtccgttgatcaataaggttccatctattaacaagc catcacccatcaaccccaggcttcttcctcaaggcactggagcactgatt ggcaagagtgcactcttgggcaccggtggtccaccatcccgcccttccag ccttacggctagccccactcctttaccagctcaaactacagcatcaccaa aaaccatcaagt
Download
page-top