Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ687404
Length 714 bp
Fasta Format > whrd10b10
gtcggggcaaatggattccagggccgccctcttctgcttcctggccgtcg cctcctccctcctgcaccccgccagatctgacggggacgacaaccagctc ctcaaggggatcaacagctacagagcttcgctcaaggtcccggcgctcac cgagaacagcaatgccgactgcctggccgagcagctagcaaagaagttca agggccaggagtgcaccaacaccaccggagccaacaccgtgcccggcacc gagccgcagttccccgactacccccagtttctcgaccgctgccacctcaa cgcgtcggtgaccgaggacgggcaggtgatgccggcatgcgtgcccggcc ttgtggccgacattgtgctgaccaactacaccaagtcccagcacaaccgg ttcctcaacgacaccaagtactccggcatcgggatcgccaacgaggggga ctgggtggtcgtcgtcctcagcaccagcaccgactccggcgactactccc ctgctcccccgggctccaactgggctccgtcggtccagccgttcagctgg atgattgtttcgctggtagggttcgtagttttgctgatgaagtgagaaga tcggtgttgtgttgttcatctcgcgtgctacaccgctgcaaatgagtgtg ttgatcttatgcccgtgccaatcatttctgtattattcanatttcatttc tacttgatccantt
Download
page-top