Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ687397
Length 703 bp
Fasta Format > whrd10a24
atcgcattcgcaaccgctctccgtttatatccccggcctcaccaccttgg catcactacttctccctcctcgcaacctttccccccgtctcgttggaatc catggcgtccaagtccgcggtcaccgcaggtgggcagcccaaggagaagg aggagccgtcctccatggcggacgtgtacaaccacgagctgacgccgctg cagaagcacgtcgccttcttcgaccggaacaaggacggcgtcatccaccc ctccgagacctacgaggggttccgcgcgatcgggtgcggcgtcgcgctgt ccgccttcagcgccgtcttcatcaacggactgctcggtcccaagaccata ccggagaacatgaaggttggtgctttcaagtttccgatctacgtaaagaa catccacaagggcaagcatgggagcgattcgggcgtgtacgatgccaatg gaaggtttgttcctgaaaagtttgaagagatattcaaaaagcatgctcac accaggcctgatgccctgacaggcaaagaactgaatgagttgcttcaagc aaacagggagccgaacgatttgaaaggacgagtgggtggcttcacagagt ggaaggttctctactcgctgtgcaaagataaggagggatttcttcacaag gagaccgtcagggcggtctacgatggcagcctgtttgtgaagttggagca aga
Download
page-top