Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ687395
Length 666 bp
Fasta Format > whrd10a22
ccctccctcccccgctctcgaatccccccgagcatcgaccatgtcggcct actgcggaaagtacaaggatgagctcatcaagaacgctgcctacattggc acccccggcaagggtatccttgctgccgacgagtccaccggcaccatcgg caagcgctttgccagcatcaatgttgagaatgttgaggacaaccgccgtg ccctccgtgagctcctcttctgcacccctggagccctccagtacctcagt ggtgtgatcctctttgaggagacactgtaccagagcaccaagggtggcaa gcccttcgttgacatcctcaaggagggcaacgtcctccctggcatcaagg tggacaagggtaccgtcgagctcgctggaaccaacggtgagaccaccacc cagggctttgatgaccttggcaagcgctgtgccaagtactacgaggctgg tgcccgctttgccaagtggcgtgccgtcctcaagattggccccaccgagc catcacagctttccatcgaccagaatgctcagggtctggctcgctatgcc atcatctgccaggagaatgggctggtgcccattgttgagcctgagatcct tgttgatggacctcatgacattgaccgctgtgcttacgtgactgagatgg tccttgctgcgtgcta
Download
page-top