Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ687389
Length 269 bp
Fasta Format > whrd10a12
cgtagataccatcaccgccgccgccgctactggtaccacctccactgcta agtacttgtaggaattaagctggcgcagtaacttgtcgccgtgccaccct tgttaattcgcgatctgtgtcgtgtgaaccttgtgtgagtttgctgctgc tgatgaagcttttgcagacgctgtctgcgttccggatctcttgcgttcct gttactgtctcgataatcgaaacctgagacgatttggtttggttgcgaag aacatggctaaaaaaaaaa
Download
page-top